Most protein interactions in organisms can be simplified as networks (PPI), but we can not locate each protein specifically in a single-layer PPI network model which makes it difficult to study the difference between PPI in special regions in an organism and the whole PPI in an organism. We divided the rice cell into several organelles to study the relationship between organelles and cell functions. Moreover, we used different cancer tissues and normal tissues in human body to construct two multilayer PPI and study the underlying mechanics of cancer comparing with the normal tissues.

　　We introduced the mathematical theories of multilayer networks along with the concept of multi-degree, overlap of edge, activity of node, multiplexity, degree correlation, participation coefficient and degree correlation coefficient, which are used to analyze the nontrivial structure and properties in PPIs of rice, cancer and normal tissue.

　　In rice PPIs, we investigated the power-law distribution of edge overlap and node activity, and found important proteins related to functional organelles in cell by analyzing participation coefficient, and organelles of strong correlations or weak correlations by analyzing heat map of layer's degree. In PPIs of cancer and normal tissue, we discovered that there are strong core structure, high homogeneousness and robustness in cancer by multiplexity diagram analysis and alignment of core networks, and the nontrivial distribution of overlap and activity. There are more core proteins in cancer than in normal tissues and various types of cancers have mostly the same core structure along with the degeneration of tissue-specified proteins. It is indicated that the core structure of cancer PPIs is related to cell proliferation, growth and transfer. Moreover, different cancers have their own specified proteins that are probably encoded by different oncogenes which lead to series of gene expressions and biochemical reactions during the formation of the same core network.

　　The former results showed that multilayer networks is a creative and powerful tool in studying complex systems and can be used in biology widely to find nontrivial properties and mechanism of biology phenomenon.

　　These five newly recorded plants enrich the content of flora in Zhejiang Province and provide fundamental materials for investigation of their geographical distributions in China.

　　In order to investigate the effects of seed coat colour on oil content and protein content more accurately, the genetic backgrounds and environments need to be kept identical as much as possible for the seeds with different colours.

　　In this study, we isolated a single gene controlled yellow seed coat mutation of B. napus L., on which yellow seeds and brown seeds were seeded in single silique simultaneously. Based on the yellow seeds and brown seeds isolated from the single plants, effects of seed coat colour on oil content and protein content were precisely measured at identical genetic backgrounds and environments. In this research, oil contents of yellow seeds and brown seeds isolated from single plants were measured by Soxhlet lipid extraction method. Protein content was measured by Hitachi L-8900 amino acids analyzer.

　　Results showed that oil contents of yellow seeds and brown seeds isolated from Plant 1 were （49.58±0.26）% and （49.90±0.28）%, respectively. Oil contents of yellow seeds and brown seeds from Plant 2 were （49.65±0.27）% and （49.36±0.25）%, respectively. That from Plant 3 and Plant 4 were （48.68±0.21）% and （48.82±0.17）%, （49.41±0.19）% and （49.46±0.13）%, respectively. The difference was not statistically significant (P=0.87). The yellow seeds and the brown seeds derived from the single plant showed the same oil content. However, the protein content was significantly improved in the yellow seeds. The total hydrolyzed amino acids contents in the yellow seed meal and the brown seed meal were （2 139.48±17.59） μmol/g and （2 063.31±24.53） μmol/g, respectively. The difference was significant (P=0.0194). The most dramatically improved amino acids were tyrosine (9.0% improved) and phenylalanine (8.5% improved) in the yellow seed meal. Aspartate and lysine contents were as well improved 6.5% and 5.2% in the yellow seed meal, respectively. Electron microscopy revealed that the cell wall of inner cell layer of seed coat was decreased in yellow seeds. It was deduced that this may be one of the causes to improve the protein content in yellow seeds. Acidic hydrolysate of seed meal showed that phenylalanine (tyrosine was from phenylalanine) was the most dramatically improved amino acid in the yellow seed meal. Real-time qPCR revealed that the genes encoding β-D-glucan exohydrolase and phenylalanine ammonia-lyase were related on the yellow seed coat mutation. Transcription of BnaA06g17630D (encoding β-D-glucan exohydrolase) in the brown seed coat was increased by 1.6 folds as compared with the yellow seed coat. Transcription of BnaA05g28470D (encoding phenylalanine ammonia-lyase) in the yellow embryo was increased by 1.8 folds as compared with the brown embryo. We hypothesized that the phenylalanine used for pigment synthesis in the brown seeds was used for protein synthesis in the yellow mutation so that protein content was improved. The amount of protein increase and fibre decrease in yellow seeds might be fair so that oil content was unaffected. It was interesting that lysine content in the brown and yellow oil seed meal was 7.35% and 7.42%, respectively, much higher than that in soybean (5.4%). Thus, it was valuable to be used as lysine additive for grain feed.

　　In conclusion, the yellow s

　　In order to reveal the effects of EBR on the salt tolerance of C. camphora, with camphor as experiment materials, we set the steadfast salt concentration at 100 mmol/L, applied different concentrations of EBR (0.1, 0.2, 0.3, 0.4, 0.5 mg/L) with the control by only using water, and observed the influence of EBR-stick treatment on camphor root morphological indexes, photosynthetic pigments and chlorophyll fluorescence parameters.

　　The results showed that: compared with the control group, at a specific salt stress, the salt injury index (SI) of camphor seedlings increased, as well as the water saturation deficit (WSD); meanwhile, the leaf relative water content, the specific leaf area, fresh and dry ratio (m_d/m_f), decreased to some extent and leaf succulence (LSE) also showed a significant decline.

　　EBR treatment with different concentrations could significantly improve the relative moisture content specific leaf areas, fresh and dry ratio and leaf succulence of camphor seedlings; reduce SI, and reached the maximum when the EBR concentration was 0.3 mg/L.

　　After suffering salt stress, the contents of chlorophyll a and chlorophyll b were significantly lower than that of the control groups, reducing 65.33% and 45.87%, respectively. The external application of EBR with different concentrations can significantly increase the content of chlorophyll of C. camphora; Chlb (chlorophyll b), Car and Chla (chlorophyll a） showed a similar variation tendency, and reached the maximum when the EBR concentration was 0.3 mg/L.

　　0.3 mg/L EBR was the best choice that could alleviate the destructive effect of salt stress on PSⅡ reaction centers. It significantly improved the Fm (maximal fluorescence), Fv/Fm (optimal/maximal photochemical efficiency of PSⅡ in the dark), Fv/Fo (potential activity of PSⅡ), ФPSⅡ (potential photochemical efficiency of PSⅡ) of camphor seedling leaves and reduced Fo (minimal fluorescence) and NPQ (non-photochemical quenching) under 100 mmol/L salt stress.

　　There were significant positive correlations among SI, WSD, Chl, specific leaf mass, and the significant negative correlations were observed with LSE, m_d/m_f. Therein, the three groups with larger correlation were: SI and water saturation deficit, water saturation deficit and chlorophyll content, leaf succulence and fresh and dry ratio. Fm, Fv/Fm, Fv/Fo, ΦPSⅡ had positive correlation with each other while had negative correlation with NPQ, Fo, Chl. Therein, the three groups with larger correlation were: Fm and Fv/Fo, Fv/Fo and ΦPSⅡ, NQP and ΦPSⅡ.

　　The potato, maize monoculture and potato intercropped with maize with 3∶2 as the ratio of the strip were selected as the research object. The relationship between soil properties and the change of soil microbial community function and structure and yield effect were analyzed in order to establish a scientific intercropping pattern and provide a theoretical basis for relieving potato continuous cropping obstacles in south mountain areas of Ningxia.

　　To reveal the relationship between crops and the effects of planting patterns on soil, potato continuous monoculture system for three years were selected as the control, the phospholipids fatty acid (PLFA) and community level physiological profiles of Eco-plate technique were used to study the composition and the functional diversity of soil microbial communities, crop yield advantage were also discussed in the monoculture and intercropping system. The strip-intercropping system with 3∶2 potato and maize, the monoculture of maize were selected as treatment, the change of soil nutrient content, soil microbial community structure, function and potato yield were separately studied.

　　The results showed that potato intercropped with maize had significant influence on the soil physical-chemical properties, the total number of soil microbial communities was enhanced and the proportion of bacteria in soil microbial communities was increased. The biomass of bacteria, actinomyces and arbuscular mycorrhizal fungi marked by phospholipid fatty acid were increased greatly and respectively by 5.56%, 11.08% and 18.08% compared with the control. The ratio of fungus biomass to bacteria biomass were decreased, the soil type were promoted and gradually changed from bacteria type to fungi type, the metabolic activity of soil microbial communities were also increased, especially for soil microbial community utilized the carboxylic acids, the polymer and the amines compounds as the carbon source. The structure of soil microbial communities was evidently affected by soil nutrient content and the increasing of soil organic m

　　Water culture method was used to examine the contents changes of Na⁺, K⁺, Ca²+, Mg²+ in different organs of alfalfa cultivars Grassland 1 (drought-resistant) and Longmu 81 (drought-sensitive) under different concentrations 10%,15%, 20%, 25% of polyethylene glycol (PEG) stress (simulating drought stress), to investigate the responses of alfalfa to drought stress regarding to ions balance.

　　The results showed that in both drought-resistant and drought-sensitive alfalfa seedlings, the content of Na⁺ increased whereas the contents of K⁺, Ca²+ and Mg²+ decreased in the roots, stems and leaves with the increase of PEG concentration. In the same condition, the ratios of K⁺ to Na⁺ (K⁺/Na⁺), Ca²+ to Na⁺ (Ca²+/Na⁺) and Mg²+ to Na⁺ (Mg²+/Na⁺) were decreased or decreased at first and then increased.

　　The increment of Na⁺ content in the roots of Grassland 1 was more than that of Longmu 81 under low concentration of PEG stress, and the same phenomenon was observed in leaves under high concentration of PEG. Besides, it was opposite in other organs under different concentrations of PEG stress. Under high concentration of PEG, the increments of K⁺ and Mg²+ contents in the roots and leaves of the Grassland 1 were more than those of Longmu 81, whereas they were less in the stems. The increment of Ca²+ content in roots, stems and leaves of the Grassland 1 were all significantly more than those of Longmu 81 under different concentrations of PEG, respectively. Compared with Longmu 81, the ratios of K⁺/Na⁺, Ca²+/Na⁺, Mg²+/Na⁺ in roots and leaves, and the ratio of Ca²+/Na⁺ in Grassland 1 were all increased under high concentration of PEG.

　　With the increase of PEG concentration, in the roots, stems and leaves of alfalfa seedlings, Na⁺ content increased whereas K⁺, Ca²+, Mg²+ contents decreased, and the ratios of K⁺/Na⁺, Ca²+/Na⁺, Mg²+/Na⁺ decreased too. When the concentration of PEG was 25%,the contents of K⁺, Ca²+, Mg²+ and the ratios of K⁺/Na⁺, Ca²+/Na⁺, Mg²+/Na⁺ in the roots and leaves of drought-resistant alfalfa (Grassland 1) were more than those of drought-sensitive one (Longmu 81), but it was not the case in stems. These suggested that the changes of ion content may be involved in the drought resistance of alfalfa.

　　Using “Sanbenti”， “11-06-25”， “Zaoxia Wuhe” and “Summer Black” and four reference varieties including two Vitis vinifera L. cv. “Muscat of Red Alexandria” and “Shien” along with two Euro-American hybrids “Shine-Muscat” and “Kyoho” as materials, an analysis of their genetic relationship by SSR (simple sequence repeat) was carried out. 35 pairs of SSR primers were screened for PCR amplification. By these primers, a total of 135 robust and reproducible bands were generated, of which 124 were polymorphic and the polymorphism frequency was 91.85%. An unweighted pair-group method with arithmetic mean (UPGMA) dendrogram of eight genotypes using NTSYS-pc 2.10e was constructed.

　　Based on our results, it could be established that “Sanbenti”, “11-06-25”, “Zaoxia Wuhe” and “Summer Black” showed high similarity. According to the parents and bud sports relation, the genetic similarity coefficient between “Sanbenti” and “11-06-25” is the highest. Although “11-06-25” and “Zaoxia Wuhe” are similar in some biological traits, the DNA band patterns of “11-06-25” and “Zaoxia Wuhe” varied in four loci (VrZAG15, VrZAG64, VMC4A1 and VMC9A2.1), suggesting that they are not identical grape lines. Besides, during preliminary observation, “11-06-25” showed better color than that of “Sanbenti”, and it also showed better in fruit quality especially aroma than that of “Zaoxia Wuhe” under the same cultivation condition.

　　In conclusion,“11-06-25” is a new grape line derived from “Sanbenti”. It is very worth popularizing because of its early maturity time and great fruit quality. In addition, we presumed that “Sanbenti” may be a bud sport of “Summer Black”.

　　J2 was characterized by hemispherical labial region, nearly continuous with round body contour and stylet knobs, three incisures in lateral field, tail tapering and tail hyaline region accounting for 55%—75%, body length ranging from 426.3 to 608.0 μm; body width ranging from 15.9 to 29.3 μm; stylet length ranging from 17.7 to 21.9 μm; dorsal gland orifice ranging from 4.3 to 6.2 μm; tail length ranging from 68.7 to 84.5 μm. Amplification of the ITS and D2/D3 fragments of the cyst-forming nematodes from bamboo with universal primers AB28 (ATATGCTTAAGTTCAGCGGGT) and TW81 (GTTTCCGTAGGTGAACCTGC), D2A (ACAAGTACCGTGA GGGAAAGTTG) and D3B (TCGGAAGGAACCAGCTACTA) yielded PCR fragments with sizes of 1 006 bp (GenBank: KX640828) and 786 bp (GenBank: KX640827), respectively, the sequences of ITS and D2/D3 of cyst nematodes parasitizing on bamboo were 99.7% and 99.6% similar to that of Heterodera koreana deposited in GenBank, respectively. Combined with morphological, morphometrics and molecular phylogeny analysis, the results showed that the cyst nematodes parasitizing on bamboo from Lin'an, Zhejiang, China is H. koreana, is a new record in Zhejiang, Eastern China.

　　Las bacterium content of HLB-infected citrus trees was detected via the qPCR technology. The detection was carried out on a monthly basis throughout the whole year at the Huangyan district of Zhejiang Province. The results showed that the content of Las bacterium for HLB-infected citrus tree varied dramatically with time in a year. The highest value for the content of Las bacterium was observed in December, followed by November, but no significant difference (P＞0.05) was found between these two months. This was the case with the other months, whose values were lower (P＜0.05) than those detected in December and November.

　　Apart from the detection for the content of Las bacterium, the Las-holding ratio of Asian citrus psyllid (Diaphorina citri) captured from HLB-infected citrus tree was also detected. The highest ratio was found in December, which was not significantly different from that in January, but significantly higher than those detected in other months at P=0.05 level. Meanwhile, the pathogen quantity of Asian citrus psyllid showed that the average content of Las bacterium was highest during the period from December to the following January. This indicated that the Las-holding ratio of Asian citrus psyllid was directly affected by the content of Las bacterium for HLB-infected citrus trees. That is, the higher the ratio of Asian citrus psyllid, the more readily the spread of citrus HLB disease. Given that the spread of citrus HLB disease reached to peak in December and January, winter and spring would be the crucial period of controlling Asian citrus psyllid in order to prevent HLB disease.

　　In order to improve the utilization rate of P. Ussurian pear resources, PUPP as a source of dietary fiber was used in ham sausage, and improve the nutrition structure of ham sausage to explore the feasibility of developing high fiber ham sausage. This paper studied basic components and physicochemical properties of peeled P. Ussurian pears pomace (PPUPP) and whole-fruit P. Ussurian pears pomace (WFPUPP) as well as PUPP as a source of dietary fiber added to ham sausage.

　　The results showed that the moisture, ash content, fat content, water-holding capacity, oil-holding capacity, water solubility index and chroma L^* & b^* value of the two kinds of PUPP were significantly different, the differences in protein, starch, dietary fiber content, pH value, chroma a^* value were not significant. The effect of ham sausage physicochemical properties of the two kinds of PUPP in different levels is not significant, and PUPP has significant effect on the textural properties. The hardness and chewiness increased with PUPP level. The hardness of the treatments added with WFPUPP and PPUPP ham sausage was increased from 3.16 N of the control group to 4.74 N and 5.00 N, respectively. While the chewiness was increased from 21.70 mJ of the control group to 32.45 mJ and 28.73 mJ, respectively. Ham sausage glue viscosity and elasticity decreased with the level of PUPP, which the viscosity in the treatment of WFPUPP and PPUPP ham sausage was reduced from 8.33 mJ in the control group to 3.67 mJ and 6.04 mJ and from 14.67 N elasticity in the contrast group to 12.05 N and 12.81 N, respectively. Different addition levels of PUPP showed significant influence on ham sensory properties including color, texture and taste, but there was no significant difference in flavor. The overall acceptability of ham added with 0.5% PUPP was the closest to the control group. 0.5%—2.0% PUPP showed no significant effect on the overall acceptability of ham, and the highest level of two kinds of PUPP incorporated into ham was 2.0%.

　　5′ flanking promoter sequence of duck RIG-1 was obtained by PCR amplification and was analyzed by bioinformatics. The expression profiles of RIG-1 were detected by qRT-PCR in immune organs during duck embryonic development, as well as the predicted transcription factors regulating RIG-1 transcription.

　　4 372 bp of duck RIG-1 promoter region was finally obtained. Bioinformatics analysis showed that typical elements, including TATA-box, CAAT-box, and binding sites of transcription factors, such as IRF-1, RXR, RAR, AP1, NF-κB, SP1, IL6 and Pax-2, were distributed in duck RIG-1 promoter region. Studies had demonstrated that IRF-1 can promote the expression of human RIG-1 and Pax-2 can inhibit the expression of mouse RIG-1. Besides, a CpG island with 65.8% GC content was predicted in duck RIG-1 promoter region, which has been found in mouse too. These data indicated that a similar transcription regulation manner may exist in duck with human and mouse. The results of qRT-PCR demonstrated that RIG-1 expression levels were dynamic in immune organs during duck embryo stages, and the expression of RIG-1 in bursa of Fabricius is higher than in spleen and thymus. Clustering of gene expression pattern showed that RIG-1 had similar expression patterns with IRF-1, RXR, AP1, NF-κB and IL6 in bursa of Fabricius, which may be due to that the bursa of Fabricius, compared with thymus and spleen, had relatively complete structure and function in duck embryo stages. This result indicated that they might regulate the transcription of RIG-1. Moreover, RIG-1 always had similar expression pattern with IRF-1 and NF-κB in bursa of Fabricius, spleen and thymus, which suggested that IRF-1 and NF-κB could regulate the expression of RIG-1.

　　It was the first report about the promoter sequence of duck RIG-1. The findings in characteristics of duck RIG-1 promoter region, and the relationships between RIG-1 and its transcription factors reflected by mRNA expression profiles in immune organs of embryonic stages may provide a basis and direction to explore transcriptional regulation and expression of duck RIG-1.

　　Seven hundred and twenty Hy-Line Brown layers (38-week-old) were divided into 6 groups with 6 replicates per group and 20 hens per replicate according to the temperature and A. argyi level, including normal temperature (control group) and normal temperature with A. argyi group, high temperature stress group and three A. argyi groups in high temperature. The two control groups were fed with a basal diet. Normal temperature with A. argyi group was fed with basal diet with 3% of A. argyi. High temperature treatments were fed with 1%, 2% and 3% of A. argyi, respectively. The preliminary trial period lasted 7 days and trial period lasted 21 days. The antioxidant ingredient and scavenging rates of A. argyi extracts for hydroxide radical, superoxide anion radical and DPPH radical were determined. The laying performance and egg quality were recorded, and the antioxidant indexes and cortisol in serum were determined every 7 days.

　　The results showed that A. argyi has higher antioxidant ingredient and better antioxidant capacity. The contents of flavonoids, total polyphenols, and vitamin C were 87.78 mg/g,126.57 mg/g, and 3.12 mg/g, respectively. The median effective dose of A. argyi extracts for scavenging hydroxide radical, superoxide anion radical and DPPH radical was 356.86 μg/mL， 76.84 μg/mL， 293.67 μg/mL, respectively. There was no significant effect of supplementation of A. argyi on the growth and laying performance in hens under normal condition (P＞0.05). Under high temperature, the hens suffered heat stress showed lower daily feed intake, lower laying rate and higher feed to egg ratio. Supplementation of A. argyi in laying hens under heat stress didn’t affect the daily feed intake compared with high temperature stress group (P>0.05), but significantly improved the antioxidant enzyme activity in serum, reduced the content of malondialdehyde and cortisol (P<0.05), increased laying rate, reduced feed to egg ratio (P<0.05), and significantly improved the yolk color and cholesterol levels (P<0.05).

　　The results indicate that A. argyi has good antioxidant effect in vitro and in vivo and can increase the antioxidant activity and improve egg quality through relieving heat stress. According to the effect and cost, the proper supplementation level of A. argyi in laying hens under heat stress is 2%.

　　Threshing is an essential and very important working procedure of rice combine harvest. The traditional threshing device has shortage in threshing capacity when harvest high yield rice, thus new type threshing device need to be developed to solve the problem.

　　Tests of connection forces between grain and petiole of four kinds of high yield rice including hybrid rice Yongyou 12, hybrid rice Yongyou 9, japonica rice Jiayou 2 and glutinous Yongyou 11 have been done. The distribution spectrum of grain connection force was drawn. The results showed that the connection force in different positions on rice spike varied widely with variant coefficient in the range of 37.1%—77.7%. The distribution of grain connection force of hybrid rice Yongyou 9 was wide but the average value was intensive. It is beneficial for selection of cylinder speed.

　　Based on the calculation of the threshing coefficients of four kinds of high yield rice, mathematical models of the relationship between the average connection force of grain with the top gear line speed and the rotational speed of the threshing cylinder were established and validated, which provided the theoretical basis for the differential-speed threshing technology. The results showed that the top gear line speed and the rotational speed of bow tooth differential-speed threshing cylinder should be selected between 9.91 m/s to 17.86 m/s and 400—720 r/min, respectively, the top gear line speed and the rotational speed of rod tooth differential-speed threshing cylinder should be selected between 800 r/min and 1 440 r/min.

　　Bow tooth differential-speed threshing cylinder and rod tooth differential-speed threshing cylinder were developed, which were used in head-feed rice combine harvester and full feeding rice combine harvester respectively. In order to verify the performance of differential-speed threshing device, contrast experiments of differential-speed threshing cylinder and single speed threshing cylinder were conducted. Distribution of mixture after threshing of different kinds of threshing device was analyzed and the components of mixture after threshing were surveyed. The results showed that the differential-speed threshing device relied on the low threshing speed to reduce the grain and stalk crushing, and relied on high threshing speed to reduce un-threshing loss. The performance indexes of loss rate, crushing rate, impurity rate of differential-speed threshing device had been effectively improved.

　　The study provides a theoretical basis and practical reference for threshing device optimization of combine harvester.

　　According to the water quality monitoring data from one of the P. vannamei breeding base in Hangzhou, a mathematical model of multi-layer feed forward neural network was established to predict and evaluate the quality of aquaculture water. The topology of the model was 40-14-4, that was, the temperature, pH value, dissolved oxygen, and oxidation-reduction potential were the input variables in m=10 consecutive time units, the number of hidden layer nodes was 14, and the output layer was 4. In order to overcome the disadvantages of traditional back propagation （BP） neural network including slow convergence speed, easy to fall into the shock, poor generalization ability and so on, the adaptive variable step size BP-neural network learning algorithm based on the fuzzy method had been developed, which can reduce the learning time of BP-neural network, improve the convergence efficiency and network stability.

　　The computed results for water quality showed good agreement with the measured values. The correlation coefficients for the temperature, pH value and the oxidation-reduction potential during the training and testing processes were better than 0.975. The comparison between the original measured and predicted values of the BP-neural network showed that the relative errors, with a few exceptions, were lower than 2.5%.

　　In conclusion, the BP-neural network model can well reveal the complicated non-linear relationship between the input and output water quality variables in intensive P. vannamei tanks, and the improved BP-neural network (FABPM) method based on fuzzy method has the characteristics of fast convergence, high accuracy and good stability. It provides a new method for the prediction and evaluation of water quality in aquaculture.